View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5088-Insertion-11 (Length: 107)
Name: NF5088-Insertion-11
Description: NF5088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5088-Insertion-11 |
 |  |
|
| [»] chr4 (9 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 3e-45; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 8 - 107
Target Start/End: Original strand, 36425473 - 36425572
Alignment:
| Q |
8 |
cttcaatcatggaagaccgacgatgaccctggaaaaggtgcgttcacggtgaaattcagcacaattggcaagccgcagttgtttatgtacaaccgtgatg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36425473 |
cttcaatcatggaagaccgacgatgaccctggaaaaggtgcgttcaccgtgaaattcagcacaattggcaaaccgcagttgtttatgtacaaccgtgatg |
36425572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 3e-30
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 36411307 - 36411405
Alignment:
| Q |
8 |
cttcaatcatggaagaccgacgatgaccctggaaaaggtgcgttcacggtgaaattcagcacaattggcaagccgcagttgtttatgtacaaccgtgat |
106 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||| || || |||||||||||||||| |||| |
|
|
| T |
36411307 |
cttcaatcctggaagacagatgatgaccctggaaaaggtgcgttcacggtgaaattcagcaccattggcaaaccacaattgtttatgtacaaccatgat |
36411405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 67; E-Value: 3e-30
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 36416638 - 36416736
Alignment:
| Q |
8 |
cttcaatcatggaagaccgacgatgaccctggaaaaggtgcgttcacggtgaaattcagcacaattggcaagccgcagttgtttatgtacaaccgtgat |
106 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||| || || |||||||||||||||| |||| |
|
|
| T |
36416638 |
cttcaatcctggaagacagatgatgaccctggaaaaggtgcgttcacggtgaaattcagcaccattggcaaaccacaattgtttatgtacaaccatgat |
36416736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 62; E-Value: 3e-27
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 36403993 - 36404086
Alignment:
| Q |
8 |
cttcaatcatggaagaccgacgatgaccctggaaaaggtgcgttcacggtgaaattcagcacaattggcaagccgcagttgtttatgtacaacc |
101 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||||||||||||||||||| |||||||||| ||||| || || ||||||||||||||||||| |
|
|
| T |
36403993 |
cttcaatcctggaagacagatgatgaccctggaaaaggtgcgttcacggtggaattcagcaccattggtaaacctcagttgtttatgtacaacc |
36404086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 36397060 - 36397153
Alignment:
| Q |
8 |
cttcaatcatggaagaccgacgatgaccctggaaaaggtgcgttcacggtgaaattcagcacaattggcaagccgcagttgtttatgtacaacc |
101 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||||||||| ||||||||||||||||||| || || | || ||||||||||||||||||| |
|
|
| T |
36397060 |
cttcaatcctggaagacagaagatgaccctggaaaaggtgcattcacggtgaaattcagcagcataggtatacctcagttgtttatgtacaacc |
36397153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 48; E-Value: 6e-19
Query Start/End: Original strand, 11 - 106
Target Start/End: Original strand, 36368705 - 36368800
Alignment:
| Q |
11 |
caatcatggaagaccgacgatgaccctggaaaaggtgcgttcacggtgaaattcagcacaattggcaagccgcagttgtttatgtacaaccgtgat |
106 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| || ||||| |||||||||||| ||||| || || ||||||||||||||||||| |||| |
|
|
| T |
36368705 |
caatcatggaagacagatgatgaccctggaaaaggcgcattcacattgaaattcagcagcattggaaaacctcagttgtttatgtacaaccatgat |
36368800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 36373318 - 36373416
Alignment:
| Q |
8 |
cttcaatcatggaagaccgacgatgaccctggaaaaggtgcgttcacggtgaaattcagcacaattggcaagccgcagttgtttatgtacaaccgtgat |
106 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||| ||||| ||||| |||||||||| || |||| ||| || ||||||||||||||||||| |||| |
|
|
| T |
36373318 |
cttcaatcctggaagacagatgatgaccctggaaatggtgcattcacagtgaaattcaacagcattgtcaaacctcagttgtttatgtacaaccatgat |
36373416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 36387277 - 36387375
Alignment:
| Q |
8 |
cttcaatcatggaagaccgacgatgaccctggaaaaggtgcgttcacggtgaaattcagcacaattggcaagccgcagttgtttatgtacaaccgtgat |
106 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||| ||||| ||||| |||||||||||||| |||||||| || || |||| |||||||||| |||| |
|
|
| T |
36387277 |
cttcaatcctggaagacggatgatgaccctggaaatggtgcattcacagtgaaattcagcaccattggcaaacctcaagtgttaatgtacaaccatgat |
36387375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 36433330 - 36433391
Alignment:
| Q |
8 |
cttcaatcatggaagaccgacgatgaccctggaaaaggtgcgttcacggtgaaattcagcac |
69 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
36433330 |
cttcaatcctggaagacagaggatgaccctggaaaaggtgccttcacgttgaaattcagcac |
36433391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University