View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5088-Insertion-12 (Length: 182)
Name: NF5088-Insertion-12
Description: NF5088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5088-Insertion-12 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 3e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 3e-34
Query Start/End: Original strand, 109 - 182
Target Start/End: Complemental strand, 38873674 - 38873601
Alignment:
| Q |
109 |
taagtgttaacttcctctcattttgtttttgttggaggttagagtttttctagtcaccgatcaagtagagattg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38873674 |
taagtgttaacttcctctcattttgtttttgttggaggttagagtttttctagtcaccgatcaagtagagattg |
38873601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 5e-30
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 38873732 - 38873662
Alignment:
| Q |
8 |
caaacactctccttacttcattcaaacactcttcacatttattctcaagcccaacaattaagtgttaactt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38873732 |
caaacactctccttacttcattcaaacactcttcacatttattctcaagcccatcaattaagtgttaactt |
38873662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 157
Target Start/End: Original strand, 27795926 - 27795973
Alignment:
| Q |
110 |
aagtgttaacttcctctcattttgtttttgttggaggttagagttttt |
157 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
27795926 |
aagtgtttacttcctctcattttgtttttgttgaaggttagggttttt |
27795973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 107 - 157
Target Start/End: Complemental strand, 7493744 - 7493694
Alignment:
| Q |
107 |
gataagtgttaacttcctctcattttgtttttgttggaggttagagttttt |
157 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7493744 |
gataagtgttaatttcctctcatttaatttttgttgaaggttagagttttt |
7493694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University