View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5088_high_18 (Length: 294)
Name: NF5088_high_18
Description: NF5088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5088_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 13 - 276
Target Start/End: Complemental strand, 22714166 - 22713901
Alignment:
| Q |
13 |
gagatgatcaacggtggttagagtagttttcaatagtcgtcattggtggtcgtagtgttggtcaaaggtgatctaaggtggttggagggatggttgactt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22714166 |
gagatgatcaacggtggttagagtagttttcaatagtcgtcattggtggtcgtagtgttggtcaaaggtgatctaaggtggttggagggatggttgactt |
22714067 |
T |
 |
| Q |
113 |
ggtcggtggtgatcagagaaatggtttgtggtggtcgtagtgttggtcgttgatggtcatcgatcgttggtggtaacatgttaacgttaaaataaataca |
212 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22714066 |
ggtcgatggtgatcagagaaatggtttttggtggtcgtagtgttggtcgttgatggtcatcgatcgttggtggtaacatgttaacgttaaaataaataca |
22713967 |
T |
 |
| Q |
213 |
agaattataaaccta--tttgtcgttttaagatttaagtgaaacctattttcaaattaagtaaaaa |
276 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22713966 |
agaattataaacctatttttgtggttttaagatttaagtgaaacctattttcaaattaagtaaaaa |
22713901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University