View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5088_low_24 (Length: 250)
Name: NF5088_low_24
Description: NF5088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5088_low_24 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 6 - 250
Target Start/End: Complemental strand, 6041420 - 6041176
Alignment:
| Q |
6 |
gagagatgaatgtgatagttccgggaccaaattgttggagtattcatttccgatatgaaaatggcaggcactacaatgggttttatttttgtcatgcaga |
105 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6041420 |
gagagaagaatgtgatagttccgggaccaaattgttggagtattcatttccgatatgaaaatggcaggcactacaatgggttttatttttgtcatgcaga |
6041321 |
T |
 |
| Q |
106 |
cgacattaaaggatcaaaatgagtcttcacacataaattaaacaattaagtgtttaaaaactgatatgttaactccttagcaattctcctattgtcacaa |
205 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6041320 |
caacattaaaggatcaaaatgagtcttcacacataaattaaacaattaagtgtttaaaaactgatatgttaactccttagcaattctcctattgtcacaa |
6041221 |
T |
 |
| Q |
206 |
tagtttcaatcaccggaagttgttcaatcaaacatagtatacctc |
250 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6041220 |
tagtttcaatcaccggaagttgttcaaccaaacatagtatacctc |
6041176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University