View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5088_low_31 (Length: 227)
Name: NF5088_low_31
Description: NF5088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5088_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 7 - 184
Target Start/End: Complemental strand, 3768550 - 3768373
Alignment:
| Q |
7 |
catataggcgttgatgcttgatggaaagatgcagagttctgaagcagatgaattcatttatcatgaatgcttgattcatccctctcttttatgtcatcca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3768550 |
catataggcgttgatgcttgatggaaagatgcagagttctgaagcagatgaattcatttatcatgaatgcttgattcatccctctcttttatgtcattca |
3768451 |
T |
 |
| Q |
107 |
aagtaagtttgttttaatatattaggggaggatgttatagttctttctttgtctttactaataaaaatgaaatattag |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3768450 |
aagtaagtttgttttaatatattaggggaggatgttatagttctttctttgtctttactaataaaaatgaaatattag |
3768373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 227
Target Start/End: Complemental strand, 3768358 - 3768330
Alignment:
| Q |
199 |
gtctgacgttatgagaattcttcgtgtat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3768358 |
gtctgacgttatgagaattcttcgtgtat |
3768330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 24 - 112
Target Start/End: Complemental strand, 48390131 - 48390043
Alignment:
| Q |
24 |
ttgatggaaagatgcagagttctgaagcagatgaattcatttatcatgaatgcttgattcatccctctcttttatgtcatccaaagtaa |
112 |
Q |
| |
|
||||||||||||||| |||| ||||| || ||||||||||||||||||||||||||||||||| |||| |||||||| || |||||| |
|
|
| T |
48390131 |
ttgatggaaagatgccgagtgctgaaatggacgaattcatttatcatgaatgcttgattcatccccctctattatgtcaccccaagtaa |
48390043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University