View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5089_low_3 (Length: 356)
Name: NF5089_low_3
Description: NF5089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5089_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 3 - 162
Target Start/End: Complemental strand, 19903933 - 19903774
Alignment:
| Q |
3 |
agagagaaagtgaaatctgctctggctggacgccggtgacctgacggcgaacacgaggatcatcgtcggggaagtcttcggtgtcgccgcgcaaggaagt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19903933 |
agagagaaagtgaaatctgctctggctggaagccggtgacctgacggcgaacacggggatcatcgtcgggtaagtcttcggtgtcgccgcgcaaggaagt |
19903834 |
T |
|
| Q |
103 |
gtcgaagggaacggtgacgggaagaaagggaccttcgagagtatttagaatgtggcagtt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19903833 |
gtcgaagggaacggtgacgggaagaaagggaccttcgagagtatttggaatgtggcagtt |
19903774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 231 - 350
Target Start/End: Complemental strand, 19903705 - 19903584
Alignment:
| Q |
231 |
tcattgttggataatggaatgtgtgaagttaattttgtttgtatttgaagggaaagtgtaagcgcgcaaga--gtcagtgaagaaagaaatggtaatggc |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
19903705 |
tcattgttggataatggaatgtgtgaagttaattttgtttgtatttgaagggaaagtgtaagcgcgcaagattgagagtgaagaaagaaatggtaatggc |
19903606 |
T |
|
| Q |
329 |
gtgagtggactctgatgatgtc |
350 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
19903605 |
gtgagtggactctgatgatgtc |
19903584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University