View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5091_high_2 (Length: 370)
Name: NF5091_high_2
Description: NF5091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5091_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 111 - 340
Target Start/End: Original strand, 34899746 - 34899975
Alignment:
| Q |
111 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899746 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
34899845 |
T |
|
| Q |
211 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899846 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
34899945 |
T |
|
| Q |
311 |
gtttggtagtttcaactttcaagttgagat |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34899946 |
gtttggtagtttcaactttcaagttgagat |
34899975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 39120106 - 39120143
Alignment:
| Q |
1 |
ctgagtggcactacaatactgcaagtcactctgccaca |
38 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39120106 |
ctgagtggcactacgatactgcaagtcactctgccaca |
39120143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 10 - 42
Target Start/End: Complemental strand, 38611453 - 38611421
Alignment:
| Q |
10 |
actacaatactgcaagtcactctgccacaggtt |
42 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
38611453 |
actacaatacagcaagtcactctgccacaggtt |
38611421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University