View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5092_high_18 (Length: 237)
Name: NF5092_high_18
Description: NF5092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5092_high_18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 45376545 - 45376764
Alignment:
| Q |
18 |
tcatgatgagtgagtagtagtgttggtaatggtgatacttctttgacgatgctgccatgttgatctagatcatcttctttgttgtttttgttaggtgatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
45376545 |
tcatgatgagtgagtagtagtgttggtaatggtgatacttctttgatgatgctgccatgttgatcaagatcatcttctttattgtttttgttaggtgatg |
45376644 |
T |
|
| Q |
118 |
atgagaagaagtccatttctttgatcggaggatctatactgttgttgtggaggaagtcgccggaggagcttaagaaggataattcacggtggtggtggtt |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45376645 |
atgagaagaaatccatttctttgatcggaggatctatactgttgttgtggaggaagtcgccggaggagcttaagaaggataattcacggtggtggtggtt |
45376744 |
T |
|
| Q |
218 |
ttccattactataaataata |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45376745 |
ttccattactataaataata |
45376764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University