View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5092_low_11 (Length: 308)
Name: NF5092_low_11
Description: NF5092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5092_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 3544601 - 3544344
Alignment:
| Q |
1 |
ttctttacaaatgatgcactcgatcgtgtcctagatatgctcactgatagagcagttatcgttagttgtcgctcgctttggccaatcacactcgcatacc |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544601 |
ttctttacaaacgatgcactcgatcgtgtcctagatatgctcactgatagagcagttatcgttagttgtcgctcgctttggccaatcacactcgcatacc |
3544502 |
T |
|
| Q |
101 |
ccatgagacattgaacacataaaacaggatagcgagtagctctgcatgaggacttgatgaacgctgacggggttatagaggattctgcagtgacaagact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544501 |
ccatgagacattgaacacataaaacaggatagcgagtagctctgcatgaggacctgatgaactctgacggggttatagaggattctgcagtgacaagact |
3544402 |
T |
|
| Q |
201 |
catgaagaccagcaaataaaccccggctctagccgccatgtttactagcaatgtagtg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3544401 |
catgaagaccagcaaataaaccccggctctagccgccatgtttactagcaatatagtg |
3544344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University