View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5092_low_13 (Length: 301)
Name: NF5092_low_13
Description: NF5092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5092_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 17 - 128
Target Start/End: Original strand, 3759272 - 3759383
Alignment:
| Q |
17 |
agttaattattgattagtactaatagtgtcattgttaatgcatgaggctagaagcatatatcatatatagatacatgaataacagaaccatttggatatt |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3759272 |
agttaattattgattagtaataatagtgtcattgttaatgcatgaggctagaagcatatatcatatatagatacatgaataacagaaccatttggatatt |
3759371 |
T |
|
| Q |
117 |
tgtttttctaag |
128 |
Q |
| |
|
||| |||||||| |
|
|
| T |
3759372 |
tgtctttctaag |
3759383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 139 - 282
Target Start/End: Original strand, 3759486 - 3759617
Alignment:
| Q |
139 |
ttgtaagtgtgatgtgaacaaaaagaacaaaaatagagtaatgcttaacctcaagaattgttgtatcgcgagatgttcacgagagacaagc---gtcatt |
235 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||| ||| |||||| |
|
|
| T |
3759486 |
ttgtaagtgcgatgtgaacaaaaagaacaaaaatagagtaatgc---------------gttgtattgcgagatgttcaggagagataagacgtgtcatt |
3759570 |
T |
|
| Q |
236 |
tattttgaccacaacaaatcctttattccaccaaatctcgaattgac |
282 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| |||||||| |
|
|
| T |
3759571 |
tattttgaccccaacaaataatttattccaccaaatctggaattgac |
3759617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University