View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5092_low_15 (Length: 264)
Name: NF5092_low_15
Description: NF5092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5092_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 3652217 - 3651987
Alignment:
| Q |
18 |
cataaatggtgttgcaaatgttgttatggtatttccttttcataataaataataaaaaggttttatttgtaccctactactcttcgaccacatgtttagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3652217 |
cataaatggtgttgcaaatgttgttatggtatttccttttcataataaataataaaaaggttttatttgtaccctactactcttggaccacatgtttagg |
3652118 |
T |
 |
| Q |
118 |
ttaatatatatacacctcaattcaattatttccagcaagaatcagctgtgtttctatatgaagtttctctaaaatataagctatgccttttgtttgggct |
217 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
3652117 |
ttaatatata--cacctcaattcaattatttccagcaagaatcagctgtgtttctatatgaagtttctctaaaatataaggtatgctttttgttttggct |
3652020 |
T |
 |
| Q |
218 |
agaagtgggtagctatctcttgttatgtggtcc |
250 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| |
|
|
| T |
3652019 |
agaagtggctagccatctcttgttatgtggtcc |
3651987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University