View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5092_low_6 (Length: 392)
Name: NF5092_low_6
Description: NF5092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5092_low_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 1 - 392
Target Start/End: Original strand, 3544583 - 3544974
Alignment:
| Q |
1 |
gtgcatcatttgtaaagaagatatcaaaagcaagaggcatcaagccaagggagtacagagccgtacaagactgcatagaaaacatgggtgacagtttgga |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544583 |
gtgcatcgtttgtaaagaagatatcaaaagcaagaggcatcaagccaagggagtacagagccgtacaagactgcatagaaaacatgggtgacagtttgga |
3544682 |
T |
 |
| Q |
101 |
cagtcttagccaatcggttagggagttaggcagtattggtcatgctgttggagaggactttgtgtggcacatgaccaacgtgcagacttgggtcagtgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544683 |
cagtcttagccaatcggttagggagttaggcagtattggtcatgctgttggagaggactttgtgtggcacatgaccaacgtgcagacttgggtcagtgct |
3544782 |
T |
 |
| Q |
201 |
gcacttactgatgataacacttgtcttgatggctttgctggtccttccatgaatggaattgttaaggctgccatcaaggacagggttgtcaatgttgctc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544783 |
gcacttactgatgataacacttgtcttgatggctttgctggtccttccatgaatggaattgttaaggctgccatcaaggacagggttgtcaatgttgctc |
3544882 |
T |
 |
| Q |
301 |
aagttaccagcaacacactcgctttggttaatcgctttgcctcaagccatcatactgcagcaactccctaaatcggtctgttgtacttgttc |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
3544883 |
aagttaccagcaacacactcgctttggttaatcgctttgcctcaagccatcgaactgcagaaactccttaaatcgttctgttgtacttgttc |
3544974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University