View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5093_low_12 (Length: 211)
Name: NF5093_low_12
Description: NF5093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5093_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 117 - 193
Target Start/End: Original strand, 56229430 - 56229506
Alignment:
| Q |
117 |
ataggaaacttgaaagttaatccttgcattgtaaattgtaatgcagtcatgagaaagcaaaagaagcaatgatatat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56229430 |
ataggaaacttgaaagttaatccttgcattgtaaattgtaatgcagtcatgagaaagcaaaagaagcaatgatatat |
56229506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 44
Target Start/End: Original strand, 56229323 - 56229357
Alignment:
| Q |
10 |
aagaatatgatgggataaaatttcaacggaacatc |
44 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
56229323 |
aagaaaatgatgggataaaatttcaacggaacatc |
56229357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 193
Target Start/End: Original strand, 39186126 - 39186168
Alignment:
| Q |
151 |
attgtaatgcagtcatgagaaagcaaaagaagcaatgatatat |
193 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
39186126 |
attgtaattcagccatgagaaagcaaaagaggcaatgatatat |
39186168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University