View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5093_low_6 (Length: 338)
Name: NF5093_low_6
Description: NF5093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5093_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 11 - 321
Target Start/End: Complemental strand, 22793080 - 22792770
Alignment:
| Q |
11 |
cagagacaacaaatgtctgttgaaatgctgatagagcatctctcaaatcctctgaaactctcgggattcctctaaactcccttccgtcatcggaactttc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22793080 |
cagaaacaacaaatgtctgttgaaatgctgatagagcatctctcaaatcctccgaaactcttgggattcctctaaactcccttccctcatcggaactttc |
22792981 |
T |
|
| Q |
111 |
accggaacctttcattgaattgttcgagtccctccttgaaccaccaccagagcttctaactgccactccttgtggcttccccgtctccgaatcagttttc |
210 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792980 |
accggaacttctcattgaattgttcgagtccctccttgaaccaccaccggagcttctaactgccactccttgtggcttccccgtctccgaatcagttttc |
22792881 |
T |
|
| Q |
211 |
aacactaacccccactccgctgctcgttgtgctgcagcggagccaggttcgttggaaactgacggagaggtggtttctttgagtgccatccaggaagtgg |
310 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792880 |
aacactaacccccactctgctgctcgttgtgctgcagcggagccaggttcgttggaaactgacggagaggtggtttctttgagtgccatccaggaagtgg |
22792781 |
T |
|
| Q |
311 |
cgacggggact |
321 |
Q |
| |
|
||||||||||| |
|
|
| T |
22792780 |
cgacggggact |
22792770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 74
Target Start/End: Complemental strand, 40954574 - 40954528
Alignment:
| Q |
28 |
tgttgaaatgctgatagagcatctctcaaatcctctgaaactctcgg |
74 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
40954574 |
tgttgaaaagctgataaagcatctttcaaatcctctgaaactctcgg |
40954528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University