View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5094_high_4 (Length: 228)
Name: NF5094_high_4
Description: NF5094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5094_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 129
Target Start/End: Original strand, 27162928 - 27162969
Alignment:
| Q |
88 |
cagcgtcagctgagtgttataactacatcttcttagcttggg |
129 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
27162928 |
cagcgtcagctgagtattatgactacatcttcttagcttggg |
27162969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 190 - 222
Target Start/End: Original strand, 27163029 - 27163061
Alignment:
| Q |
190 |
gttatcagtatataaaggttgtctatttggttg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27163029 |
gttatcagtatataaaggttgtctatttggttg |
27163061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University