View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5095-Insertion-4 (Length: 211)
Name: NF5095-Insertion-4
Description: NF5095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5095-Insertion-4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 211
Target Start/End: Complemental strand, 54183783 - 54183580
Alignment:
| Q |
8 |
gaattcagtggactaaaatcaacttcatgcattacctatgccagtaatgctagagagtcttctttttctgatgttgtagctgttcaactcgcaaccaagg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54183783 |
gaattcagtggactaaaatcaacttcatgcattacctatgccagtaatgctagagagtcttctttttctgatgttgtagctgctcaactcgcaaccaagg |
54183684 |
T |
|
| Q |
108 |
ttattttctagttacatgttttatatatctcattggatcatgagcaattccttccttcttttatatgtcacatagatgtattagctccgatgaagcactg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54183683 |
ttattttctagttacatgttttatatatctcattggatcatgagcaattccttccttcttttatatgtcacatagatgtattagctcctatgaagcactg |
54183584 |
T |
|
| Q |
208 |
acac |
211 |
Q |
| |
|
|||| |
|
|
| T |
54183583 |
acac |
54183580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University