View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5096_high_5 (Length: 220)
Name: NF5096_high_5
Description: NF5096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5096_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 1500795 - 1500605
Alignment:
| Q |
16 |
gagatgaagtgatgattgaataaactaata---gaaatagatggagaaattggcgaactagaagacgattttcaccgtaaggccaattatagagaccgat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1500795 |
gagatgaagtgatgattgaataaactaataatagaaatagatggagaaattggcgaactagaagacgattttcatcgtaaggccaattatagagaccgat |
1500696 |
T |
 |
| Q |
113 |
tttaggaaaattgggagttgaggttgagctttggaaatgagatgaaaaatggttaaatgtttggattttgtgggttacaaatatttcactc |
203 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1500695 |
tttaggaaaattggaagttgaggttgagctttggaaatgagatgaaaaatggttaaatgtttggattttgtgggttacaaatatttcactc |
1500605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 1504066 - 1504026
Alignment:
| Q |
120 |
aaattgggagttgaggttgagctttggaaatgagatgaaaa |
160 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
1504066 |
aaattgagagttgaggttgagttttggaaatgagctgaaaa |
1504026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University