View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5096_low_5 (Length: 220)

Name: NF5096_low_5
Description: NF5096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5096_low_5
NF5096_low_5
[»] chr5 (2 HSPs)
chr5 (16-203)||(1500605-1500795)
chr5 (120-160)||(1504026-1504066)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 1500795 - 1500605
Alignment:
16 gagatgaagtgatgattgaataaactaata---gaaatagatggagaaattggcgaactagaagacgattttcaccgtaaggccaattatagagaccgat 112  Q
    ||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
1500795 gagatgaagtgatgattgaataaactaataatagaaatagatggagaaattggcgaactagaagacgattttcatcgtaaggccaattatagagaccgat 1500696  T
113 tttaggaaaattgggagttgaggttgagctttggaaatgagatgaaaaatggttaaatgtttggattttgtgggttacaaatatttcactc 203  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1500695 tttaggaaaattggaagttgaggttgagctttggaaatgagatgaaaaatggttaaatgtttggattttgtgggttacaaatatttcactc 1500605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 1504066 - 1504026
Alignment:
120 aaattgggagttgaggttgagctttggaaatgagatgaaaa 160  Q
    |||||| |||||||||||||| |||||||||||| ||||||    
1504066 aaattgagagttgaggttgagttttggaaatgagctgaaaa 1504026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University