View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5097_high_12 (Length: 262)
Name: NF5097_high_12
Description: NF5097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5097_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 4 - 250
Target Start/End: Complemental strand, 41975808 - 41975562
Alignment:
| Q |
4 |
gtaatagcaaaggctttatactatatggtttcataggttgcgccgtattactacaactgtgttacaagttagagagctattcctgccttaattacttgtc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41975808 |
gtaatagcaaaggctttatactatatggtttcataggttgcgccgtattactacaactgtgttacaagttagagagctattcctgcctttattacttgtc |
41975709 |
T |
 |
| Q |
104 |
tatttatcgcactagttccttgatgctattgagataaatcgttatttgcaattttgaaaattctctagctaattctcgtagattgnnnnnnncattgaaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41975708 |
tatttatcgcactagttccttgatgctattgagataaattgttatttgcaattttgaaaattctctagctaattctcgtagattgtttttttcattgaaa |
41975609 |
T |
 |
| Q |
204 |
ttctcgtagattattgagacttgtaaattctatctttacgccacttc |
250 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41975608 |
ttctcgttgattattgagacttgtaaattctatctttacgccacttc |
41975562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University