View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5097_high_7 (Length: 398)
Name: NF5097_high_7
Description: NF5097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5097_high_7 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 9e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 243 - 398
Target Start/End: Original strand, 375087 - 375242
Alignment:
| Q |
243 |
ttgggttttgaagtaaatggtacttacgaacagtggagggaatatcagtagaagcatactgagatttcttgagtctgtgttgaagatgagcagcgatcca |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
375087 |
ttgggttttgaagtaaatggtacttacgaacagtggagggaatatcagtagaagcatactgagatttcttgagtctgtgttgaagatgagcagcgatcca |
375186 |
T |
 |
| Q |
343 |
aaccgttgagagtggtccttttcgcgccaaaaacgtttgagagtaaaacattcttc |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
375187 |
aaccgttgagagtggtccttttcgcgccaaaaacgtttgagagtaaaacattcttc |
375242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 125 - 213
Target Start/End: Original strand, 374979 - 375067
Alignment:
| Q |
125 |
cccaatagaataaacaacatcaaccctccaaagatcataaaacccatataggaatttgagaaaaattcaatctttaaaactttaagatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
374979 |
cccaatagaataaacaacatcaaccctccaaagatcacaaaacccatataggaatttgagaaaaatttaatcttttaaactttaagatg |
375067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University