View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5097_low_13 (Length: 252)

Name: NF5097_low_13
Description: NF5097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5097_low_13
NF5097_low_13
[»] chr8 (2 HSPs)
chr8 (45-177)||(45151177-45151309)
chr8 (20-49)||(45151117-45151146)


Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 45 - 177
Target Start/End: Original strand, 45151177 - 45151309
Alignment:
45 tatcacattggtatttatactactaggctatataactgattttgttaaacatctaacatggcttaactagctcttaagtgttaatagataactaagaact 144  Q
    |||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||    
45151177 tatcacataggtgtgtatactactaggctatataactgattttgttaaacatctaacagggcttaactagctcttaagtgttaacagataactgagaact 45151276  T
145 aattcctattccttgtacataattttgactgat 177  Q
    |||||||||||||||||||||||||||||||||    
45151277 aattcctattccttgtacataattttgactgat 45151309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 49
Target Start/End: Original strand, 45151117 - 45151146
Alignment:
20 aggaagtgaagataaattgaaaatgtatca 49  Q
    ||||||||||||||||||||||||||||||    
45151117 aggaagtgaagataaattgaaaatgtatca 45151146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University