View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5097_low_17 (Length: 225)
Name: NF5097_low_17
Description: NF5097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5097_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 40712874 - 40712659
Alignment:
| Q |
1 |
ctttaatttatcaatgatttatataattgatattatactctgaaaaacgaagtgttcactttaaatgtgccagattcataacatgtacataaacatcata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40712874 |
ctttaatttatcaatgatttatataattgatattatactctaaaaaacgaagtgttcactttaaatgtgccagattcataacatgtacataaacatcata |
40712775 |
T |
|
| Q |
101 |
aacctgtttgctagagaagtcaacggtatcatccttttgcaaacagtgttttaagttggcactccaccacagcaaaagggacgaaagaggatcctttcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
40712774 |
aacctgtttgctagagaagtcaacggtatcatccttttgcaagcagtgttttaagttggcactccaccacagctaaaaggacgaaagaggatcctttcaa |
40712675 |
T |
|
| Q |
201 |
ctttggacagtattat |
216 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
40712674 |
ctttgaacagtattat |
40712659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University