View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5097_low_18 (Length: 218)

Name: NF5097_low_18
Description: NF5097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5097_low_18
NF5097_low_18
[»] chr2 (1 HSPs)
chr2 (131-206)||(7332415-7332490)


Alignment Details
Target: chr2 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 131 - 206
Target Start/End: Complemental strand, 7332490 - 7332415
Alignment:
131 acaattgccgatgaacgagttgactcagcttgataatcttgatgaagnnnnnnnngagaaacaattgatgatgatg 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||    
7332490 acaattgccgatgaacgagttgactcagcttgataatcttgatgaagaagaaaaagagaaacaattgatgatgatg 7332415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University