View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5097_low_9 (Length: 357)
Name: NF5097_low_9
Description: NF5097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5097_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 347
Target Start/End: Complemental strand, 607269 - 606921
Alignment:
| Q |
1 |
gtaacatgtatatatgtttgctctactacctagattttaacctttttgagataacctgaagcaacttagaactgtactaaattgagtatccacatatgtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
607269 |
gtaacatgtatatatgtttgctctactacctagattttaacctttttgagataacctgaagcaacttagaactgtactaaattgagtatccacttatgtc |
607170 |
T |
|
| Q |
101 |
tgtcgtaccaatttgggggaccaacatatccataactctgaaacaaaatcaaaaattgaatcgtcgtgtctttatt--gtgtatttgatccacttgtgac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
607169 |
tgtcgtaccaatttgggggaccaacatatccataactctgaaacaaaatcaaaaattgaatcgtcgtgtctttattgtgtgtatttgatccacttgtgac |
607070 |
T |
|
| Q |
199 |
tttgtgaggatatatatgatttgcgaaagagatatgtgatgtgagtagtgctcatcttgttaaagtgggtagaaatagcatacttccatcataattccgt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
607069 |
tttgtgaggatatatatgatttgcgaaagagatatgtgatgtgagtagtgctcatcttgttaaagtgggtagaaatagcatacttccatcataattccgt |
606970 |
T |
|
| Q |
299 |
tgacaactcatccatcctacctcatatgtacctgtaacctattcctttg |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
606969 |
tgacaactcatccatcctacctcatatgtacctgtaatctattcctttg |
606921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University