View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5098_high_11 (Length: 321)
Name: NF5098_high_11
Description: NF5098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5098_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 314
Target Start/End: Original strand, 32860623 - 32860936
Alignment:
| Q |
1 |
aaagaaccacaataacacaccatatcaattttatttttccacaatctatactgtgttatgtaaaccaacactcattgtgcttctatcattgttacattcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860623 |
aaagaaccacaataacacaccatatcaattttatttttccacaatctatactgtgttatgtaaaccaacactcattgtgcttctatcattgttacattcc |
32860722 |
T |
|
| Q |
101 |
ctgtagcaatgacacatgtcggacgaagccgacaacacttatgataagaaaggatacaaaacctgacatggtgttccgcaataccaaacaacttgacaac |
200 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860723 |
ctgcaacaatgacacatgtcggacgaagccgacaacacttatgataagaaaggatacaaaacctgacatggtgttccgcaataccaaacaacttgacaac |
32860822 |
T |
|
| Q |
201 |
gtgagcatttgctaaggttagttgttgagaaacatccatcacaccttttttgagttggaacacaaacatagggctcttggctaataatcacatcccctgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860823 |
gtgagcatttgctaaggttagttgttgagaaacatccatcacaccttttttgagttggaacacaaacatagggctcttggctaataatcacatcccctgc |
32860922 |
T |
|
| Q |
301 |
aatgcaacaccaaa |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32860923 |
aatgcaacaccaaa |
32860936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University