View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5099_high_4 (Length: 360)
Name: NF5099_high_4
Description: NF5099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5099_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 56 - 352
Target Start/End: Complemental strand, 47037627 - 47037326
Alignment:
| Q |
56 |
aacactactcttagaaccaaacactaggtccaactcaatagaccatcaacgcctataaaaaggcactgttagccatcaaaaggtactaacaatataaagt |
155 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
47037627 |
aacactactcttagacccaaacactaggtccaagtcaatagaccatcaacacctataaaaaggcactgttagccatcaaaaggtaattacaatataaagt |
47037528 |
T |
|
| Q |
156 |
ttaacctctcactct-----cttttattagcttgagcgtaaaagtgtgtgcaaatactcacaactcgcatattgacggtcattgctccaattcgcgttga |
250 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
47037527 |
ttaacctctcactctttgctcttttactagcttgagcgtaaaagtgtctgcaaatactcacaactcgcatattgacggttattgctccaattcgcattga |
47037428 |
T |
|
| Q |
251 |
ggtagttgttgcttgacaaacaaaatcattctaatcactctatagcaatatgnnnnnnngaagacacttgcgttttttgtgaactatgttatcttgatga |
350 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47037427 |
ggcggttgttgcttgacaaacaaaatcattctaatcactctatatcaatatgttttttttaagacacttgcgttttttgtgaactatattatcttgatga |
47037328 |
T |
|
| Q |
351 |
tg |
352 |
Q |
| |
|
|| |
|
|
| T |
47037327 |
tg |
47037326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 56
Target Start/End: Complemental strand, 47037688 - 47037650
Alignment:
| Q |
18 |
caaaggttcaatcccgcgaagtccaaatacagataaaga |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037688 |
caaaggttcaatcccgcgaagtccaaatacagataaaga |
47037650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University