View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5099_high_9 (Length: 215)
Name: NF5099_high_9
Description: NF5099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5099_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 47560990 - 47560813
Alignment:
| Q |
19 |
tcaagagcgttgaaacaccaaattctcttctttttatataaagatcctttccacgttttagaagctattagttttttgaaagaattgcttaatttcttcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47560990 |
tcaagagcgttgaaacaccaaattctcttctttttatataaagatcctttccacgttttagaagctattagttttttgaaagaattgcttaatttcttcc |
47560891 |
T |
 |
| Q |
119 |
tcctttctttgcttgtttattttacttttacaacaagggggaatagtaaaacagcatgcctggaacaatccaatgaga |
196 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47560890 |
tcccttctttgcttgtttattttacttttacaacaagggggaatagtaaaacagcatgcctggaacaatccaatgaga |
47560813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University