View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5100_high_10 (Length: 216)
Name: NF5100_high_10
Description: NF5100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5100_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 4424561 - 4424758
Alignment:
| Q |
1 |
aggtcgtgtcgaactctcaaaggtgaacacataacaccagtcatggggaaaatccactttgtttatttcatcactttcattgagcatataataaaggtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4424561 |
aggtcgtgtcgaactctcaaaggtgaacacataacaccagtcatggggaaaatctactttgtttatttcatcactttcattgagcatttaataaaggtaa |
4424660 |
T |
|
| Q |
101 |
acaaatcccgagaaaagcattgaaataattttaaattcttaaaaagaaggaatacgccattgccaaacacttgctcacagtttcaaataaattaattt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4424661 |
acaaatcccgagaaaagcattgaaataattttaaattcttaaaaagaaggaatacgccattgccaaacacttgctcacagtttcaaatgaattaattt |
4424758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University