View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5100_high_5 (Length: 342)
Name: NF5100_high_5
Description: NF5100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5100_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 24 - 327
Target Start/End: Complemental strand, 54472391 - 54472088
Alignment:
| Q |
24 |
attaacttcctccattaactattctaaacttcataacatgcttatttgcaaattcctattnnnnnnngaaataggagatatataaaaatatataccgtgt |
123 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54472391 |
attagcttcccccattaactattctaaacttcataacatgcttatttgcaaattcctattaaaaaaagaaataggagatatataaaaatatataccgtgt |
54472292 |
T |
 |
| Q |
124 |
gctggagtagggtagtaatgaatgtgatgaggttgtgatctcttcttccttcttgtacatataacgcagagtaggataatgacaaggaggattatacaag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472291 |
gctggagtagggtagtaatgaatgtgatgaggttgtgatctcttcttccttcttgtacatataacgcagagtaggataatgacaaggaggattatacaag |
54472192 |
T |
 |
| Q |
224 |
ctgcacctgcaactgctattataccacccacgctcaattgattcccattgttatcatttgtattgttgccgttgttcgagggtgatgatttatgatgatg |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472191 |
ctgcacctgcaactgctattataccacccacgctcaattgattcccattgttatcatttgtattgttgccgttgttcgagggtgatgatttatgatgatg |
54472092 |
T |
 |
| Q |
324 |
atgt |
327 |
Q |
| |
|
|||| |
|
|
| T |
54472091 |
atgt |
54472088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University