View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5100_low_12 (Length: 207)
Name: NF5100_low_12
Description: NF5100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5100_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 6 - 71
Target Start/End: Original strand, 2091089 - 2091154
Alignment:
| Q |
6 |
atctagcttgtttcttcattgtctatcacaatataagaataaagtttcgagaaacaaagaaatata |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2091089 |
atctagcttgtttcttcattgtctatcacaatataagaataaagtttcgagaaacaaagcaatata |
2091154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 102 - 187
Target Start/End: Original strand, 2091182 - 2091267
Alignment:
| Q |
102 |
gaagttgaaattctcattattatatgaattgtaaatttatactttatattnnnnnnnttaaagattataaatttatactttctttc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
2091182 |
gaagttgaaattctcattattatatgaattgtaaatttatactttatattaaaaaaattaaagattataaatttataatttctttc |
2091267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University