View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5101_low_10 (Length: 227)
Name: NF5101_low_10
Description: NF5101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5101_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 602281 - 602080
Alignment:
| Q |
14 |
aatactatgcaaaacatcaaatttatggtta------tggttatgatatgattggtatgtagtactcttatttgcttctccttgtannnnnnnnnaatag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
602281 |
aatactatgcaaaacatcaaatttatggttaaggttatggttatgatatgattggtatgtagtactcttatttgcttctccttgtatttttttttaatag |
602182 |
T |
 |
| Q |
108 |
gtcatcaactaatcataaagacgatatgaatttctattgtcaaaacaaatcatcgattgttgtcagaattttaaacaatttttaaatatttgtccgtatt |
207 |
Q |
| |
|
|| |||| |||| ||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
602181 |
gttatcacctaaccataaagacgatatgaacttctattttcaaaacacatcatcgattgttgtcagaattttaaacaatttttaaatatttgtccgtatt |
602082 |
T |
 |
| Q |
208 |
ga |
209 |
Q |
| |
|
|| |
|
|
| T |
602081 |
ga |
602080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 93
Target Start/End: Complemental strand, 805090 - 805016
Alignment:
| Q |
19 |
tatgcaaaacatcaaatttatggttatggttatgatatgattggtatgtagtactcttatttgcttctccttgta |
93 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||| || | ||||||||||||| ||||| || |||||||| |
|
|
| T |
805090 |
tatgcaaaacatcaactttttggttatggttatgataggaaagatatgtagtactctcatttgtttttccttgta |
805016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University