View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5101_low_7 (Length: 248)
Name: NF5101_low_7
Description: NF5101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5101_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 40033554 - 40033762
Alignment:
| Q |
19 |
agtatattatagggggctcagagagtggcggtgcatgcaaaaacaaagggcaattccgtcaaaataaagaaaaacgacgctgcaccatataaatcatgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033554 |
agtatattatagggggctcagagagtggcggtgcatgcaaaaacaaagggcaattccgtcaaaataaagaaaaacgacgctgcaccatataaatcatgta |
40033653 |
T |
 |
| Q |
119 |
accctgtttattctctcaccatttcattttctctaccggttctagggtttctgagtaacttcattcaaggtaaatttctttcgcacaatttagggtacaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40033654 |
accctgtttattctctcaccatttcattttc---------tctagggtttctgagtaacttcattcaaggtaaatttctttctcacaatttagggtacaa |
40033744 |
T |
 |
| Q |
219 |
tttcatttctatttgatg |
236 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
40033745 |
tttcgtttctatttgatg |
40033762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University