View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5103-Insertion-20 (Length: 166)
Name: NF5103-Insertion-20
Description: NF5103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5103-Insertion-20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 1e-73; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 8 - 159
Target Start/End: Original strand, 11558709 - 11558860
Alignment:
| Q |
8 |
gcaactgcatttcagttattaaggtatttaccatttctttaaaatttatgcttcaattgtatatataaaatgatgacaactcttaaaccctagaatttat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11558709 |
gcaactgcatttcagttattaaggtatttaccatttctttaaaatttatgcttcaattgtgtatataaaatgatgacaactcttaaaccctagagtttat |
11558808 |
T |
|
| Q |
108 |
tcggtatagtatacaacatccaatcacttataattaattatattgattccaa |
159 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11558809 |
tcggtatagtatataacatccaatcacttataattaattatattgattccaa |
11558860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 8 - 105
Target Start/End: Original strand, 11545247 - 11545345
Alignment:
| Q |
8 |
gcaactgcatttcagttattaaggtatttaccatttcttt-aaaatttatgcttcaattgtatatataaaatgatgacaactcttaaaccctagaattt |
105 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||||||||| |||||||||||||||||||| |||||||||| |||||||||| || ||||||||||| |
|
|
| T |
11545247 |
gcaattgcatttcaattatcaaggtatttaccatttcttttaaaatttatgcttcaattgtgtatataaaattatgacaactcctatgccctagaattt |
11545345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 101 - 139
Target Start/End: Original strand, 11545372 - 11545410
Alignment:
| Q |
101 |
aatttattcggtatagtatacaacatccaatcacttata |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11545372 |
aatttattcggtatagtatacaacatccaattacttata |
11545410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University