View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5103-Insertion-9 (Length: 50)
Name: NF5103-Insertion-9
Description: NF5103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5103-Insertion-9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 9 - 50
Target Start/End: Original strand, 36333579 - 36333620
Alignment:
| Q |
9 |
ctcatgacctccctccgatccgatttcggtggaccccagttc |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333579 |
ctcatgacctccctccgatccgatttcggtggaccccagttc |
36333620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University