View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5103_high_15 (Length: 298)
Name: NF5103_high_15
Description: NF5103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5103_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 10 - 283
Target Start/End: Complemental strand, 43142315 - 43142041
Alignment:
| Q |
10 |
gcacagaccaaaccttttcaggggaatgtgtcctatatgactactgttactcttggaagattggcctgataggagtgctcaagctcatttatgtcatgac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142315 |
gcacagaccaaaccttttcaggggaatgtgtcctatatgactactgttactcttggaagattggcctgataggagtgctcaagctcatttatgtcatgac |
43142216 |
T |
 |
| Q |
110 |
aaaggaaagaaaggctattgccattcttcatagcatccttcatttgtttgatcgctctgttcctgtaagggggaagatgcagtctttctcataggcgcat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142215 |
aaaggaaagaaaggctattgccattcttcatagcatctttcatttgtttgatcgctctgttcctgtaagggggaagatgcagtctttctcataggcgcat |
43142116 |
T |
 |
| Q |
210 |
gacaacggaagcgtttccagattctatgacattcattattaagtaatgagtacctaaaat-agaagcaaaagcat |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
43142115 |
gacaacggaagcgtttccagattctatgacattcattattaagtaatgagtacctaaaataagaagcaagagcat |
43142041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 46 - 180
Target Start/End: Complemental strand, 43153875 - 43153741
Alignment:
| Q |
46 |
atgactactgttactcttggaagattggcctgataggagtgctcaagctcatttatgtcatgacaaaggaaagaaaggctattgccattcttcatagcat |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||| | |
|
|
| T |
43153875 |
atgactactgttactcttggaagattggcctgatagaagtgctcaagctcatttatgtcatgacataggaaagaaagactattgccattctgcatagctt |
43153776 |
T |
 |
| Q |
146 |
ccttcatttgtttgatcgctctgttcctgtaaggg |
180 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
43153775 |
ccttcatttgttttatctctctgttcctgtaaggg |
43153741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University