View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5103_high_31 (Length: 231)
Name: NF5103_high_31
Description: NF5103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5103_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 43142513 - 43142739
Alignment:
| Q |
1 |
cattcatgtttttaatcatttgctattaagctttgcaaccttaaactcattttaagtttggttttttataccccgttaccgtgatggaaccagcaaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142513 |
cattcatgtttttaatcatttgctattaagctttgcaaccttaaactcattttaagtttggttttttataccccgttaccgtgatggaaccagcaaaact |
43142612 |
T |
 |
| Q |
101 |
tctgtgtcaaagtctgttcagttccttctgagccctttcatgaatttcttcctttctcaggttgtatattctaatcttgtcggcatctcactaaattgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43142613 |
tctgtgtcaaagtctgttcagttccttctgagccctttcatgaatttcttcctttctcaggttgtatattctaatcttgtcggcatcccactaaattgga |
43142712 |
T |
 |
| Q |
201 |
tttatgcttgatgtatgcaggatgatg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43142713 |
tttatgcttgatgtatgcaggatgatg |
43142739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 100 - 227
Target Start/End: Original strand, 43154563 - 43154691
Alignment:
| Q |
100 |
ttctgtgtcaaagtctgttcagttccttctgagccctttcatgaatttcttcctttctcaggttgtatattctaatcttgtcggcatctcactaaattgg |
199 |
Q |
| |
|
||||||||||||| || | ||||||||||| ||||| ||||||||| |||||||| ||||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
43154563 |
ttctgtgtcaaagcttgatttgttccttctgaccccttgcatgaatttattcctttcataggttgtatgttctaatcttatcggcatttcactaaattgg |
43154662 |
T |
 |
| Q |
200 |
atttatgc-ttgatgtatgcaggatgatg |
227 |
Q |
| |
|
|| |||| ||||| |||||||||||||| |
|
|
| T |
43154663 |
atgcatgctttgatatatgcaggatgatg |
43154691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University