View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5103_low_19 (Length: 267)
Name: NF5103_low_19
Description: NF5103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5103_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 60 - 251
Target Start/End: Complemental strand, 1763550 - 1763359
Alignment:
| Q |
60 |
attgagaaccctaacaaaaatgagaaaatctttatagttttacatttgtcatgatcattagatttttgtcatgtgaagagcaactccatggccaggttct |
159 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1763550 |
attgagaaccccaacaaaaatgagaaaatctttatagttttacattggtcatgatcattagatttttgtcatgtgaagagcaactccatggccaggttct |
1763451 |
T |
 |
| Q |
160 |
acaagcatgtggtagaaaggtgaatgacaataacttgatgatagagagaactgaaacttcaacaagatgagagacaagatcaccttcaattc |
251 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1763450 |
acaagcatgtggtaggaaggtgaatgacaataacttgatgatagagagaactgaaacttcaacaaaatgagagacaagatcaccttcaattc |
1763359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 252
Target Start/End: Complemental strand, 25197896 - 25197822
Alignment:
| Q |
178 |
ggtgaatgacaataacttgatgatagagagaactgaaacttcaacaagatgagagacaagatcaccttcaattct |
252 |
Q |
| |
|
||||||||||| ||| |||| || |||||||| ||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
25197896 |
ggtgaatgacagtaagttgacgacagagagaatcgaaactttgacagaatgagagacaatatcaccttcaattct |
25197822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University