View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5103_low_23 (Length: 251)
Name: NF5103_low_23
Description: NF5103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5103_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 36940093 - 36939882
Alignment:
| Q |
16 |
atgcattggtcacacaaagattgggaggaataaaatgtctagtgnnnnnnnncattgaagtcagataaatactatctttatcagtccaagctattgaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36940093 |
atgcattggtcacacaaagattgggaggaataaaatgt-tagtgaaaaaaaacattgaagtcagataaatactatctttatcagtccaagctattgaaaa |
36939995 |
T |
 |
| Q |
116 |
gttcacatcacctacatttgaaacttcattnnnnnnnncaaggtttgaaaaagtcttatcctatcttttctatagtttgtgtttcgcaccaaccaaacca |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36939994 |
gttcacatcaccttcatttgaaacttcattaaaaaaa-caaggtttgaaaaagtcttatcctatcttttctatagtttgtgtttcgcaccaaccaaacca |
36939896 |
T |
 |
| Q |
216 |
aacacatggtccca |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36939895 |
aacacatggtccca |
36939882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University