View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5103_low_5 (Length: 443)
Name: NF5103_low_5
Description: NF5103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5103_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 2e-56; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 293 - 404
Target Start/End: Original strand, 37758456 - 37758567
Alignment:
| Q |
293 |
ttggagatcttagggataaatcatgaatgtgtgattggtctgtttatttatacaaataatgcatttggtaaaaatgaaaatatatggtttggatatttcg |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37758456 |
ttggagatcttagggataaatcatgaatgtgtgattggtctgtttatttatacaaataatgcatttggtaaaaatgaaaatatatggtttggatatttcg |
37758555 |
T |
 |
| Q |
393 |
aaggggcaaagg |
404 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37758556 |
aaggggcaaagg |
37758567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 11 - 88
Target Start/End: Original strand, 37758182 - 37758259
Alignment:
| Q |
11 |
cagagactaatccatcattagctcctaatacggctgcgcgaagccattgagccctttgccaataatcaatatctgaag |
88 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37758182 |
cagaaactaatccatcattagctcctaatacggctgcgcgaagccattgagccctttgccaataatcaatatctgaag |
37758259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 146 - 206
Target Start/End: Original strand, 37758317 - 37758377
Alignment:
| Q |
146 |
gaattgtgattactttgtttagtgactcagaatcacatattgtaccaacggccattggtac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37758317 |
gaattgtgattactttgtttagtgactcagaatcacatattgtaccaacggccattggtac |
37758377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University