View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5104-Insertion-13 (Length: 318)

Name: NF5104-Insertion-13
Description: NF5104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5104-Insertion-13
NF5104-Insertion-13
[»] chr4 (2 HSPs)
chr4 (194-318)||(8750096-8750219)
chr4 (8-117)||(8750294-8750403)
[»] chr3 (1 HSPs)
chr3 (194-268)||(54547994-54548068)
[»] chr5 (1 HSPs)
chr5 (262-302)||(18160091-18160130)


Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 194 - 318
Target Start/End: Complemental strand, 8750219 - 8750096
Alignment:
194 aattaaaaaattacacacatgacatctcagtcatttaagtgaggtgtcacttgtgtattgattggataaaaattgatccgggggaccaaaactgcaaaat 293  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||    
8750219 aattaaaaaattacacacgtgacatctcagtcatttaagtgaggtgtcacttgtgtattgactggataaaaattgatcc-ggggaccaaaactgcaaaat 8750121  T
294 gggctaaacttatgaagctgagttg 318  Q
    |||||||||||||| ||||||||||    
8750120 gggctaaacttatggagctgagttg 8750096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 8750403 - 8750294
Alignment:
8 gataaggcatagacaaagttgtagttactctcatatttgctttctatttgctgggcttggttatgagaagaaagagatagatgttcatcccatctccacg 107  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||    
8750403 gataaggcatagacaaagttgtagttgctctcatatttgctttctatttgctgggtttggttatgaggagaaagagatagatgttcatcccatctccacg 8750304  T
108 attctttgcc 117  Q
    ||||||||||    
8750303 attctttgcc 8750294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 268
Target Start/End: Complemental strand, 54548068 - 54547994
Alignment:
194 aattaaaaaattacacacatgacatctcagtcatttaagtgaggtgtcacttgtgtattgattggataaaaattg 268  Q
    |||||||||||||||||| || ||||  ||||| ||||| ||| |||||| ||||| ||| |||||| |||||||    
54548068 aattaaaaaattacacacgtggcatcctagtcacttaagcgagatgtcacatgtgtgttggttggatcaaaattg 54547994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 302
Target Start/End: Original strand, 18160091 - 18160130
Alignment:
262 aaaattgatccgggggaccaaaactgcaaaatgggctaaac 302  Q
    ||||||||||||||||| ||||||||||||| |||||||||    
18160091 aaaattgatccgggggatcaaaactgcaaaa-gggctaaac 18160130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University