View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5104_high_14 (Length: 244)

Name: NF5104_high_14
Description: NF5104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5104_high_14
NF5104_high_14
[»] chr3 (1 HSPs)
chr3 (1-244)||(53147096-53147336)


Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 53147096 - 53147336
Alignment:
1 ataacagccccatcatattgtttgcccagtaagggaaccttgatcatagcactgtgtaacaatacttttcagaagcccttcagtctaccttcttaaaatt 100  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
53147096 ataacagccccattatattgtttgcccagtaagggaaccttgatcatagcactgtgtaacaatacttttcagaagcccttcagtctaccttcttaaaaat 53147195  T
101 atacagtttcatgtagcttatagatcactactatgatttgagttactactactactaagtactgtaatagcttaatgttttaaaaattaaacaacaattt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||   |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
53147196 atacagtttcatgtagcttatagatcactactatgatttgagt---tactactactaactactgtaatagcttaatgttttaaaaattaaacaacaattt 53147292  T
201 atttcgtggatctacattggttattctgcacatggtaattcaat 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
53147293 atttcgtggatctacattggttattctgcacatggtaattcaat 53147336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University