View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5104_high_19 (Length: 227)
Name: NF5104_high_19
Description: NF5104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5104_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 11 - 209
Target Start/End: Complemental strand, 38432558 - 38432346
Alignment:
| Q |
11 |
agtgagatgaagtgggatcttaaggtgttaattttttattcaattcttgatcaatttaattggttatctcatctcaagttcgtcctttggtggatgtttt |
110 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38432558 |
agtgacatggagtgggatcttaaggtgttaattttttattcaattcttgatcaatttaattggttatctcatctgaagttcgtcctttggtggatgtttt |
38432459 |
T |
 |
| Q |
111 |
gttattcttctttatgagttctttgtc--------------tttggtcgtggtttgtctaagatgcattaaattgataatgatactctagaatcctttat |
196 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
38432458 |
gttattcttctttatgagttctttgtctttgttgctggagctttggtcgtggtttgtctaagatgcattaaattggtaatgatacactagaatcctttat |
38432359 |
T |
 |
| Q |
197 |
tgtttaagagttt |
209 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
38432358 |
tctttaagagttt |
38432346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University