View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5104_high_2 (Length: 574)
Name: NF5104_high_2
Description: NF5104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5104_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 2e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 347 - 468
Target Start/End: Original strand, 1237748 - 1237869
Alignment:
| Q |
347 |
aaatgagataggaatgtcgttggctacaaacatcttaacaagttcattttggcaagcttcttggtcaaacttgttaaatttctgccttttgcttccatca |
446 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
1237748 |
aaatgagataggaatgtcgttggctacaaacatcttaacaagttcattttggcaagcttcttggtcaaacttgttagatttttgccttttgcttccatca |
1237847 |
T |
|
| Q |
447 |
ctttgctcatctgtaaagtgat |
468 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1237848 |
ctttgctcatctgtaaagtgat |
1237869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 514 - 564
Target Start/End: Original strand, 1237868 - 1237918
Alignment:
| Q |
514 |
atacacaagtagtgttagagccaaatggtggagtagaaaactgattctctg |
564 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1237868 |
atacacaagtagtgttagagccaaatggtggagtagaaaactgattctctg |
1237918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University