View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5104_low_12 (Length: 257)
Name: NF5104_low_12
Description: NF5104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5104_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 47965331 - 47965277
Alignment:
| Q |
19 |
gaaattgtacgctattcctacgccaaaaattgaacatcgacgatatttttgcata |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
47965331 |
gaaattgtacgctattcctacgccaaaaattgaacattgacgatatgtttgcata |
47965277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 189 - 236
Target Start/End: Complemental strand, 47965278 - 47965231
Alignment:
| Q |
189 |
tagagagggtaaggtgttttgtttagactcttgcaatttgttatcagc |
236 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47965278 |
tagagagggtgaggtgttttgtttagactcttgcaatttgttatcagc |
47965231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University