View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5104_low_15 (Length: 244)
Name: NF5104_low_15
Description: NF5104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5104_low_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 53147096 - 53147336
Alignment:
| Q |
1 |
ataacagccccatcatattgtttgcccagtaagggaaccttgatcatagcactgtgtaacaatacttttcagaagcccttcagtctaccttcttaaaatt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
53147096 |
ataacagccccattatattgtttgcccagtaagggaaccttgatcatagcactgtgtaacaatacttttcagaagcccttcagtctaccttcttaaaaat |
53147195 |
T |
 |
| Q |
101 |
atacagtttcatgtagcttatagatcactactatgatttgagttactactactactaagtactgtaatagcttaatgttttaaaaattaaacaacaattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53147196 |
atacagtttcatgtagcttatagatcactactatgatttgagt---tactactactaactactgtaatagcttaatgttttaaaaattaaacaacaattt |
53147292 |
T |
 |
| Q |
201 |
atttcgtggatctacattggttattctgcacatggtaattcaat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53147293 |
atttcgtggatctacattggttattctgcacatggtaattcaat |
53147336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University