View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5105-Insertion-3 (Length: 180)
Name: NF5105-Insertion-3
Description: NF5105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5105-Insertion-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 6e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 6e-85
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 26372296 - 26372126
Alignment:
| Q |
8 |
tcatcagcatggctcttcttgtttaaagcatttttccacacttgaaaggatgaactagcactgctcattagcttagttggagccatggaagaggagggtt |
107 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26372296 |
tcatcatcatggctcttcttgcctaaagcatttttccacacttgaaaggatgaactagcactgctcattagcttagttggagccatggaagaggagggtt |
26372197 |
T |
|
| Q |
108 |
tgaagctaatggtggatttcacagcagttaacttatccttttttgagctcagaaaattgattttctttgca |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26372196 |
tgaagctaatggtggatttcacagcagttaacttatccttttttgagctcagaaaattgattttctttgca |
26372126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University