View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5106_high_17 (Length: 259)
Name: NF5106_high_17
Description: NF5106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5106_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 25296892 - 25297140
Alignment:
| Q |
1 |
ctctattttatcattttatgtaatttttaaattcagttaggtgtctttgttcgtttagaggttactttggaataggttacctacaaaggataattaattt |
100 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||| | |
|
|
| T |
25296892 |
ctctattttatcatctcatgtaatttttaaatccatttaggtgtctttgttcgtttagaggttactttgcaatagtttacctataaaggataattaatgt |
25296991 |
T |
 |
| Q |
101 |
aaaagaggtattagtccacaaaattctcagttatgtat---tggtggttgcggcaatttggaaacaacaaatcacctcnnnnnnnnaattgtaatatttt |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25296992 |
aaaaaaggtattagtccacaaaattctcagttatgtattaatggtggttgccgcaatttggaaacaacaaatcacct-ttttttttaattgtaatatttt |
25297090 |
T |
 |
| Q |
198 |
tggttcgttatggcatcatgtgcttaattggttaggcttcttttcggttc |
247 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25297091 |
tggttccttatggcatcatgtgcttaattagttaggcttcttttcggttc |
25297140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University