View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5106_high_21 (Length: 223)
Name: NF5106_high_21
Description: NF5106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5106_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 18 - 165
Target Start/End: Original strand, 25296538 - 25296685
Alignment:
| Q |
18 |
gaaatggcgtacttctaccgttggacataattttccgacgaatgaattggacgttagagggttttacacaagatgatttgggttggtatagggttttagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25296538 |
gaaatggcgtacttctaccgttggacataattttccgaggaatgaattggacgttagagggttttacacaagatgatttgggttggtatggggttttagg |
25296637 |
T |
|
| Q |
118 |
ggttgttctgtatatatagtgaggcggtttgagagactactgagaaaa |
165 |
Q |
| |
|
||||||| ||||||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
25296638 |
ggttgttttgtatatatagggaggcggttagagatactactgagaaaa |
25296685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University