View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5106_low_21 (Length: 223)

Name: NF5106_low_21
Description: NF5106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5106_low_21
NF5106_low_21
[»] chr1 (1 HSPs)
chr1 (18-165)||(25296538-25296685)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 18 - 165
Target Start/End: Original strand, 25296538 - 25296685
Alignment:
18 gaaatggcgtacttctaccgttggacataattttccgacgaatgaattggacgttagagggttttacacaagatgatttgggttggtatagggttttagg 117  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
25296538 gaaatggcgtacttctaccgttggacataattttccgaggaatgaattggacgttagagggttttacacaagatgatttgggttggtatggggttttagg 25296637  T
118 ggttgttctgtatatatagtgaggcggtttgagagactactgagaaaa 165  Q
    ||||||| ||||||||||| ||||||||| |||| |||||||||||||    
25296638 ggttgttttgtatatatagggaggcggttagagatactactgagaaaa 25296685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University