View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5107-Insertion-7 (Length: 156)
Name: NF5107-Insertion-7
Description: NF5107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5107-Insertion-7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 8 - 156
Target Start/End: Original strand, 38924745 - 38924893
Alignment:
| Q |
8 |
atttgaaccccaaagaagacgcacactgtgccactcggatccacaataacacaccatctgaacaggttttgacagatagaaatcatatccaaaagtgcta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38924745 |
atttgaaccccaaagaagacgcacactgtgccacttggatccacaataacacaccatctgaacaggttttgatagatagaaatcatatccaaaagtgcta |
38924844 |
T |
 |
| Q |
108 |
cttaactaggttgattattttagaaaaatacgaattacattttttaaga |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38924845 |
cttaactaggttgattattttagaaaaatacgaattacattttttaaga |
38924893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University